ZFIN ID: ZDB-GENE-980526-41

ZFIN ID: ZDB-GENE-980526-41

Mapping Details

Gene Name:	sonic hedgehog signaling molecule b
Symbol:	shhb

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	2	33,009,884 - 33,014,768	GRCz12tu
NCBI Map Viewer	2	33,009,884 - 33,014,768	GRCz12tu
Ensembl	2	30,050,541 - 30,055,432	GRCz11
NCBI Map Viewer	2	30,050,547 - 30,055,381	GRCz11
UCSC	2	-	GRCz11
Vega	2	30,067,008 - 30,071,899	GRCv10

Mapped Clones containing shhb
DKEY-265A7	Chr: 2 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa2069	2	33,010,888	GRCz12tu	DIRECT		Sealy et al., 2025
	2	30,051,551	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	2	30,068,018	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	2	29,766,383	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa5719	2	33,010,888	GRCz12tu	DIRECT		Sealy et al., 2025
	2	30,051,551	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	2	30,068,018	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	2	29,766,383	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa8431	2	33,014,378	GRCz12tu	DIRECT		Sealy et al., 2025
	2	30,054,991	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	2	30,071,458	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	2	29,769,823	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa25111	2	33,010,593	GRCz12tu	DIRECT		Sealy et al., 2025
	2	30,051,256	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	2	30,067,723	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	2	29,766,088	Zv9	DIRECT		Busch-Nentwich et al., 2013
la023573Tg	2	29,766,919 - 29,766,929	Zv9	ZFIN_Zv9	BurgessLin
la028783Tg	2	29,766,742 - 29,766,752	Zv9	ZFIN_Zv9	BurgessLin
hg127	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	2		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
hg128	2		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
la023573Tg	2		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
la028783Tg	2		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa2069	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	2		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa5719	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	2		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa8431	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	2		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa25111	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	2		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	2		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
2	113.9 cM	twhh	Mother of Pearl (MOP)	Postlethwait, John H.	Data
2	2766.0 cR	twhh	Goodfellow T51 (T51)	Geisler, Robert	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Primer Sets:
Strain	Bandsize	Annealing Temperature [C]
SJD	450	36.0
Forward Primer	GATATCGAATTCGACTGCTGCTGTACATT
Reverse Primer	GGAAAACATCCTCCTGA

Genomic Feature la028783Tg is an allele of shhb