| ZFIN ID: ZDB-GENE-980526-135 |
| Gene Name: | Indian hedgehog signaling molecule b |
|---|---|
| Symbol: | ihhb |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing ihhb | |
|---|---|
| CH211-237C6 | Chr: 6 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa20623 | 6 | 7,992,864 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 6 | 7,060,492 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 6 | 6,903,323 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 6 | 6,977,307 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 6 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 6 | 36.6 cM | ehh | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 6 | 558.0 cR | ehh | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 6 | 25.5 cM | ehh | Heat Shock (HS) | Woods, Ian G. | Data |
| 6 | 27.94 cM | ehh | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 378 | MseI | 36.0 |
| Forward Primer | CGATGCTCAAGTGGGTCAGT | ||
| Reverse Primer | CTCCACCAATCCCTGCGT |
| Genomic Feature sa20623 is an allele of ihhb |