ZFIN ID: ZDB-GENE-980526-442 |
Gene Name: | growth differentiation factor 6b |
---|---|
Symbol: | gdf6b |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing gdf6b | |
---|---|
DKEY-158E13 | Chr: 19 Details |
CH211-244A23 | Chr: 19 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
sa23521 | 19 | 23,001,848 | GRCz11 | Busch-Nentwich et al., 2013 |
19 | 23,417,525 | GRCz10 | Busch-Nentwich et al., 2013 | |
19 | 23,488,110 | Zv9 | Busch-Nentwich et al., 2013 | |
sa36836 | 19 | 23,001,828 | GRCz11 | Busch-Nentwich et al., 2013 |
19 | 23,417,505 | GRCz10 | Busch-Nentwich et al., 2013 | |
19 | 23,488,090 | Zv9 | Busch-Nentwich et al., 2013 | |
sa43280 | 19 | 23,001,818 | GRCz11 | Busch-Nentwich et al., 2013 |
19 | 23,417,495 | GRCz10 | Busch-Nentwich et al., 2013 | |
19 | 23,488,080 | Zv9 | Busch-Nentwich et al., 2013 | |
zf3339 | 19 | 22,999,561 - 22,999,568 | GRCz11 | Gramann et al., 2019 |
sa23521 | 19 | GRCz11 | ||
19 | GRCz11 | |||
19 | GRCz11 | |||
19 | GRCz11 | |||
sa36836 | 19 | GRCz11 | ||
19 | GRCz11 | |||
19 | GRCz11 | |||
19 | GRCz11 | |||
sa43280 | 19 | GRCz11 | ||
19 | GRCz11 | |||
19 | GRCz11 | |||
19 | GRCz11 | |||
zf3339 | 19 | GRCz11 | ||
19 | GRCz11 | |||
19 | GRCz11 | |||
19 | GRCz11 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
19 | 94.3 cM | dynamo | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
19 | 66.6 cM | gdf6b | Heat Shock (HS) | Woods, Ian G. | Data |
19 | 40.42 cM | dynamo | Gates et al (GAT) | Talbot, William S. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
mc5ra | GENE | 19 | 0.0 cM | Ringholm et al., 2002 | Ringholm et al. (2002, J Neurochem 82(1):6-18) report mapping mc5ra to LG 19, 12.3 cM from hoxa11a, indistinguishably close to gdf6b, using the Heat Shock mapping panel. |
hoxa11a | GENE | 19 | Ringholm et al., 2002 | Ringholm et al. (2002, J Neurochem 82(1):6-18) report mapping mc5ra to LG 19, 12.3 cM from hoxa11a, indistinguishably close to gdf6b, using the Heat Shock mapping panel. |
Markers Encoded by gdf6b | |||
---|---|---|---|
fc13c07 Chr: 19 Details |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 204 | 36.0 | |
Forward Primer | TGTTTTTATCCAAGCAGTTCTCAC | ||
Reverse Primer | CATTCTTGCCGTATTTTGCTCTCC |
Genomic Feature sa43280 is an allele of gdf6b |