| ZFIN ID: ZDB-GENE-980526-249 |
| Gene Name: | wingless-type MMTV integration site family, member 11 |
|---|---|
| Symbol: | wnt11 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing wnt11 | |
|---|---|
| DKEY-250D21 | Chr: 10 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| sa2545 | 10 | 37,115,536 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 10 | 32,116,982 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 10 | 32,173,122 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 10 | 33,071,773 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa27632 | 10 | 37,115,603 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 10 | 32,117,049 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 10 | 32,173,189 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 10 | 33,071,840 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| fh224 | 10 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| fh225 | 10 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| wnt11_unrecovered | 10 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 10 | 91.3 cM | wnt11r | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 10 | 52.4 cM | wnt11r | Heat Shock (HS) | Woods, Ian G. | Data |
| 10 | 46.86 cM | wnt11r | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by wnt11 | |||
|---|---|---|---|
| fk73h04 Chr: 10 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 732 | 36.0 | |
| Forward Primer | CCGAGGCTACAACCCTTACA | ||
| Reverse Primer | CAGAGAGGTTTTGCCGTTTCT |
| Genomic Feature sa27632 is an allele of wnt11 |