ZFIN ID: ZDB-GENE-980526-562

Mapping Details

Gene Name: ISL LIM homeobox 2a
Symbol: isl2a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 25 35,183,457 - 35,189,436 GRCz12tu
NCBI Map Viewer 25 35,183,457 - 35,189,436 GRCz12tu
NCBI Map Viewer 25 32,746,014 - 32,752,001 GRCz11
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
ca20 25 32,748,968 - 32,748,969 GRCz11 DIRECT Lamont et al., 2016
ca21 25 32,748,951 - 32,748,970 GRCz11 DIRECT Lamont et al., 2016
co7002 25 32,751,402 - 32,751,414 GRCz11 DIRECT Moreno et al., 2018
sa24713 25 35,186,450 GRCz12tu DIRECT Sealy et al., 2025
25 32,749,011 GRCz11 DIRECT Busch-Nentwich et al., 2013
25 32,341,947 GRCz10 DIRECT Busch-Nentwich et al., 2013
25 33,731,635 Zv9 DIRECT Busch-Nentwich et al., 2013
sa24714 25 35,188,901 GRCz12tu DIRECT Sealy et al., 2025
25 32,751,466 GRCz11 DIRECT Busch-Nentwich et al., 2013
25 32,344,402 GRCz10 DIRECT Busch-Nentwich et al., 2013
25 33,734,090 Zv9 DIRECT Busch-Nentwich et al., 2013
uhm2 25 32,751,459 - 32,751,468 GRCz11 DIRECT Witzel et al., 2017
zf3989 25 32,750,149 - 32,750,150 GRCz11 DIRECT Yan et al., 2023
ca20 25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ca21 25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
co7002 25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
co7003 25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa24713 25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa24714 25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
uhm2 25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
zf3989 25 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
25 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
25 118.8 cM islet2 Mother of Pearl (MOP) Postlethwait, John H. Data
25 481.3 cR islet2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
25 490.08 cR isl2 Loeb/NIH/5000/4000 (LN54) Johnson, Stephen L. Data
25 3583.0 cR isl2 Goodfellow T51 (T51) Geisler, Robert Data
25 75.4 cM isl2 Heat Shock (HS) Woods, Ian G. Data
25 78.77 cM isl2 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by isl2a
fc29g02 Chr: 25 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1080 NlaIII 36.0
Forward Primer CGGGGAACATTCACTCTAGC
Reverse Primer TAATACTGTCCGAACACGCG
Genomic Feature ca20 is an allele of isl2a