ZFIN ID: ZDB-GENE-980526-41

Mapping Details

Gene Name: sonic hedgehog signaling molecule b
Symbol: shhb
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 2 33,009,884 - 33,014,768 GRCz12tu
NCBI Map Viewer 2 33,009,884 - 33,014,768 GRCz12tu
Ensembl 2 30,050,541 - 30,055,432 GRCz11
NCBI Map Viewer 2 30,050,547 - 30,055,381 GRCz11
UCSC 2 - GRCz11
Vega 2 30,067,008 - 30,071,899 GRCv10
Mapped Clones containing shhb
DKEY-265A7 Chr: 2 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa2069 2 33,010,888 GRCz12tu DIRECT Sealy et al., 2025
2 30,051,551 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 30,068,018 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 29,766,383 Zv9 DIRECT Busch-Nentwich et al., 2013
sa5719 2 33,010,888 GRCz12tu DIRECT Sealy et al., 2025
2 30,051,551 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 30,068,018 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 29,766,383 Zv9 DIRECT Busch-Nentwich et al., 2013
sa8431 2 33,014,378 GRCz12tu DIRECT Sealy et al., 2025
2 30,054,991 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 30,071,458 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 29,769,823 Zv9 DIRECT Busch-Nentwich et al., 2013
sa25111 2 33,010,593 GRCz12tu DIRECT Sealy et al., 2025
2 30,051,256 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 30,067,723 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 29,766,088 Zv9 DIRECT Busch-Nentwich et al., 2013
la023573Tg 2 29,766,919 - 29,766,929 Zv9 ZFIN_Zv9 BurgessLin
la028783Tg 2 29,766,742 - 29,766,752 Zv9 ZFIN_Zv9 BurgessLin
hg127 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
hg128 2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
la023573Tg 2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
la028783Tg 2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa2069 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa5719 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa8431 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa25111 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
2 113.9 cM twhh Mother of Pearl (MOP) Postlethwait, John H. Data
2 2766.0 cR twhh Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 450 36.0
Forward Primer GATATCGAATTCGACTGCTGCTGTACATT
Reverse Primer GGAAAACATCCTCCTGA
Genomic Feature hg127 is an allele of shhb