| ZFIN ID: ZDB-GENE-980526-26 |
| Gene Name: | muscle segment homeobox 1b |
|---|---|
| Symbol: | msx1b |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing msx1b | |
|---|---|
| DKEYP-80C12 | Chr: 1 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa39680 | 1 | 52,667,326 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 1 | 49,354,462 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 1 | 48,710,042 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 1 | 49,860,861 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 1 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| zko947a | 1 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| zko947b | 1 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 1 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 1 | 145.6 cM | msxb | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 1 | 443.28 cR | msxB | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 1 | 455.11 cR | msxb | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 1 | 6043.0 cR | msxb | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 1 | 74.9 cM | msxb | Heat Shock (HS) | Woods, Ian G. | Data |
| 1 | 91.86 cM | msxb | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| lef1 | GENE | 1 | Phillips et al., 2006 | ||
| Df(Chr01:lef1,msxb)x8 | Feature | 1 | Phillips et al., 2006 |
|
| Markers Encoded by msx1b | |||
|---|---|---|---|
| fk04h02 Chr: 1 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 421 | MspI | 36.0 |
| Forward Primer | TATTTAACGGACCCGTGTCC | ||
| Reverse Primer | ACGGATAACCTCCGTGTCAG |
| Genomic Feature zko947b is an allele of msx1b |