| ZFIN ID: ZDB-GENE-980526-144 |
| Gene Name: | hes family bHLH transcription factor 1 |
|---|---|
| Symbol: | hes1 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing hes1 | |
|---|---|
| DKEY-111K7 | Chr: 6 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| co3005 | 6 | 36,552,295 - 36,552,298 | GRCz11 | DIRECT | Stenzel et al., 2022 |
| m1358 | 6 | 39,109,825 - 39,110,111 | GRCz12tu | DIRECT | Sigloch et al., 2023 |
| sa20748 | 6 | 39,109,969 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 6 | 36,552,252 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 6 | 36,574,358 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 6 | 36,330,824 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa38559 | 6 | 39,110,152 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 6 | 36,552,435 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 6 | 36,574,541 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 6 | 36,331,007 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sud29 | 6 | 39,110,014 - 39,110,018 | GRCz12tu | DIRECT | Tsuruoka et al., 2025 |
| co3005 | 6 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| el633 | 6 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| sa59 | 6 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| umc301Tg | 6 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 6 | 134.1 cM | her6 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 6 | 352.38 cR | HER-6 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 6 | 74.43 cM | her6 | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 419 | 36.0 | |
| Forward Primer | GCAACCGACGGACAGTTCGC | ||
| Reverse Primer | AACGTGGAAAGATACCGCAAATA |