ZFIN ID: ZDB-GENE-980526-144

Mapping Details

Gene Name: hairy-related 6
Symbol: her6
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 6 39,108,800 - 39,110,485 GRCz12tu
NCBI Map Viewer 6 39,108,800 - 39,110,485 GRCz12tu
Ensembl 6 36,551,083 - 36,552,844 GRCz11
NCBI Map Viewer 6 36,551,083 - 36,552,768 GRCz11
UCSC 6 - GRCz11
Vega 6 36,573,189 - 36,574,950 GRCv10
Mapped Clones containing her6
DKEY-111K7 Chr: 6 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
co3005 6 36,552,295 - 36,552,298 GRCz11 DIRECT Stenzel et al., 2022
sa20748 6 39,109,969 GRCz12tu DIRECT Sealy et al., 2025
6 36,552,252 GRCz11 DIRECT Busch-Nentwich et al., 2013
6 36,574,358 GRCz10 DIRECT Busch-Nentwich et al., 2013
6 36,330,824 Zv9 DIRECT Busch-Nentwich et al., 2013
sa38559 6 39,110,152 GRCz12tu DIRECT Sealy et al., 2025
6 36,552,435 GRCz11 DIRECT Busch-Nentwich et al., 2013
6 36,574,541 GRCz10 DIRECT Busch-Nentwich et al., 2013
6 36,331,007 Zv9 DIRECT Busch-Nentwich et al., 2013
sud29 6 39,110,014 - 39,110,018 GRCz12tu DIRECT Tsuruoka et al., 2025
co3005 6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
el633 6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa59 6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa20748 6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa38559 6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
umc301Tg 6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
6 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
6 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
6 134.1 cM her6 Mother of Pearl (MOP) Postlethwait, John H. Data
6 352.38 cR HER-6 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
6 74.43 cM her6 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 419 36.0
Forward Primer GCAACCGACGGACAGTTCGC
Reverse Primer AACGTGGAAAGATACCGCAAATA
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.