ZFIN ID: ZDB-GENE-980526-174

Mapping Details

Gene Name: achaete-scute family bHLH transcription factor 1b
Symbol: ascl1b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 7 51,555,216 - 51,556,643 GRCz12tu
NCBI Map Viewer 7 51,555,216 - 51,556,643 GRCz12tu
Ensembl 7 49,715,750 - 49,717,195 GRCz11
NCBI Map Viewer 7 49,715,769 - 49,717,196 GRCz11
UCSC 7 - GRCz11
Vega 7 49,442,974 - 49,444,419 GRCv10
Mapped Clones containing ascl1b
CH211-210P4 Chr: 7 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa38638 7 51,552,550 GRCz12tu DIRECT Sealy et al., 2025
7 49,713,103 GRCz11 DIRECT Busch-Nentwich et al., 2013
7 49,440,327 GRCz10 DIRECT Busch-Nentwich et al., 2013
7 51,170,091 Zv9 DIRECT Busch-Nentwich et al., 2013
sa41003 7 51,543,052 GRCz12tu DIRECT Sealy et al., 2025
7 49,703,660 GRCz11 DIRECT Busch-Nentwich et al., 2013
7 49,430,884 GRCz10 DIRECT Busch-Nentwich et al., 2013
7 51,160,648 Zv9 DIRECT Busch-Nentwich et al., 2013
ulg002 7 49,716,173 - 49,716,183 GRCz11 DIRECT Ghaye et al., 2015
is75Tg 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa38638 7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa41003 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ulg002 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 126.6 cM zashb Mother of Pearl (MOP) Postlethwait, John H. Data
7 203.93 cR zash-b Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
7 120.6 cM ashb Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 581 36.0
Forward Primer CTCCATCCGTCTCCAACG
Reverse Primer GTGCATGGGCTTCCTAGTGT
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.