ZFIN ID: ZDB-GENE-980526-178

Mapping Details

Gene Name: fibroblast growth factor 3
Symbol: fgf3
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 7 69,563,782 - 69,566,134 GRCz12tu
NCBI Map Viewer 7 69,563,782 - 69,566,134 GRCz12tu
Ensembl 7 54,605,640 - 54,609,108 GRCz11
NCBI Map Viewer 7 54,606,242 - 54,608,594 GRCz11
UCSC 7 Based on NM_131291 GRCz11
Vega 7 54,335,988 - 54,339,456 GRCv10
Mapped Clones containing fgf3
CH211-96B20 Chr: 7 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source Citations
gnu48 7 69,563,901 - 69,563,905 GRCz12tu DIRECT Jeon et al., 2025
fgf3_unspecified 7 GRCz11 OTHER_MAPPING ZFIN Curated Data
psi60Tg 7 GRCz11 OTHER_MAPPING ZFIN Curated Data
t21142 7 GRCz11 OTHER_MAPPING ZFIN Curated Data
t24149 7 GRCz11 OTHER_MAPPING ZFIN Curated Data
t24152 7 GRCz11 OTHER_MAPPING ZFIN Curated Data
t26212 7 GRCz11 OTHER_MAPPING ZFIN Curated Data
y323Et 7 GRCz11 OTHER_MAPPING ZFIN Curated Data

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 151.2 cM fgf3 Mother of Pearl (MOP) Postlethwait, John H. Data
7 262.32 cR fgf3 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
7 5890.0 cR fgf3 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
t24152 Feature 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to  ...
z41496 SSLP 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to  ...
z41496 SSLP 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to  ...
z8540 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z8604 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z9869 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z11625 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z1059 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z13880 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z1182 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z20576 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z20715 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z1239 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z3008 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z3445 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z6852 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z7244 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z7958 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z8156 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z8218 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z26442 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z14401 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
fd21a02 EST 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
fb64c10 EST 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
fi19d09 EST 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
fb64f09 EST 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
fb12g02 EST 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
fa11d03 EST 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
fc89b01 EST 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
dtv43 Feature 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z14644 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...
z8252 SSLP 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ...

OTHER MAPPING INFORMATION
Chr 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7,  ...
Chr 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7,  ...
Chr 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map  ...
Genomic Feature t24152 is an allele of fgf3
Marker Type Chr Distance Publication / Person Comments
fgf3 GENE 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to  ...
z41496 SSLP 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to  ...
Genomic Feature t21142 is an allele of fgf3
Chr 7 Herzog et al., 2004 Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or  ...
Genomic Feature t24149 is an allele of fgf3
Chr 7 Herzog et al., 2004 Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or  ...
Genomic Feature t24152 is an allele of fgf3
Chr 7 Herzog et al., 2004 Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or  ...
Chr 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7,  ...
Genomic Feature t26212 is an allele of fgf3
Chr 7 Herzog et al., 2004 Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 611 Mnl1 36.0
Forward Primer CTCCATTACTAGCATGCGCA
Reverse Primer CTCATGAATGCGCTCCAGAA