ZFIN ID: ZDB-GENE-980526-285

ZFIN ID: ZDB-GENE-980526-285

Mapping Details

Gene Name:	cathepsin Lb
Symbol:	ctslb

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN JBrowse	12	16,691,584 - 16,694,092	GRCz11
Ensembl	12	16,691,584 - 16,694,092	GRCz11
Vega	12	16,595,994 - 16,598,560	GRCv10
Vega	12	16,495,264 - 16,497,883	GRCv10
Vega	12	16,569,710 - 16,572,218	GRCv10

Mapped Clones containing ctslb
DKEY-239J18	Chr: 12 Details
DKEY-269I1	Chr: 12 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa22068	12	18,213,098	GRCz12tu	DIRECT		Sealy et al., 2025
	12	16,617,977	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	12	16,496,103	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	12	17,684,929	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa27926	12	18,287,780	GRCz12tu	DIRECT		Sealy et al., 2025
	12	16,692,662	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	12	16,570,788	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	12	17,759,614	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa44754	12	18,213,528	GRCz12tu	DIRECT		Sealy et al., 2025
	12	16,618,407	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	12	16,496,533	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	12	17,685,359	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa22068	12		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa27926	12		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa44754	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	12		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
12	184.44 cR	hgg1	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
12	2034.0 cR	hgg1	Goodfellow T51 (T51)	Geisler, Robert	Data
12	48.9 cM	hgg1	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by ctslb
fb30g09 Chr: 12 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	278	HaeIII	36.0
Forward Primer	GCTACATCTACATGGCAAAAGAC
Reverse Primer	GCAGGTCAAATAGATCCAGTACA