| ZFIN ID: ZDB-GENE-980526-404 |
| Gene Name: | forkhead box A2 |
|---|---|
| Symbol: | foxa2 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing foxa2 | |
|---|---|
| DKEY-208C12 | Chr: 17 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| tv53a | 17 | GRCz11 | GENERAL_LOAD | load data [singleton] | ||
| st20 | 17 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 17 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 17 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 17 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 17 | GRCz11 | OTHER_MAPPING | linkagesDirectMem1 | |||
| 17 | GRCz11 | OTHER_MAPPING | linkagesDirectMem2 | |||
| tv53a | 17 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 17 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 17 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 17 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 17 | GRCz11 | OTHER_MAPPING | linkagesDirectMem1 | |||
| 17 | GRCz11 | OTHER_MAPPING | linkagesDirectMem2 |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 17 | 165.0 cM | axial | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 17 | 333.51 cR | foxa2 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 17 | 4132.0 cR | foxa2 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 17 | 98.8 cM | foxa2 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| tv53a | Feature | 17 | Norton et al., 2005 | Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the same position as foxa2. |
|
| Markers Encoded by foxa2 | ||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| fe05g04 Chr: 17 Details | ||||||||||||||||||||||||||
| tdsubc_2g8 Chr: 17 Details | ||||||||||||||||||||||||||
| Genomic Feature st20 is an allele of foxa2 | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||
| Genomic Feature tv53a is an allele of foxa2 | ||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||||||||
| Genomic Feature tv53a is an allele of foxa2 | |||
|---|---|---|---|
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 454 | Tsp509I | 36.0 |
| Forward Primer | GACATACGAGCAAGTGATGCA | ||
| Reverse Primer | GCGAAAAAAGTCCAAATAACA |