| ZFIN ID: ZDB-GENE-980526-526 | 
| Gene Name: | wingless-type MMTV integration site family, member 1 | 
|---|---|
| Symbol: | wnt1 | 
PHYSICAL MAP AND BROWSER
                    
                    
                
            
        
    
    
        
        
            
    
    
    | 
            
            
                
                
                    
                     | 
        ||||||||||||||||||||||||||||
                
  | 
        
| Mapped Clones containing wnt1 | |
|---|---|
| DKEY-166N8 | Chr: 23 Details | 
PHYSICAL MAPPING 
                    
                    
                
            
        
    
    
        
        
    | Feature | Chr | Position | Assembly | Source | DetailedSource | Citations | 
|---|---|---|---|---|---|---|
| sa24353 | 23 | 30,576,578 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 23 | 27,654,925 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 23 | 27,728,384 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 23 | 27,895,562 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 23 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 23 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 23 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| tud49Tg | 23 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 23 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 23 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| tud50Tg | 23 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 23 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 23 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | 
| Chr | Location | Mapped As | Panel | Mapped By | Scoring | 
|---|---|---|---|---|---|
| 23 | 111.3 cM | wnt1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data | 
| 23 | 282.89 cR | wnt1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data | 
| 23 | 4234.0 cR | wnt1 | Goodfellow T51 (T51) | Geisler, Robert | Data | 
| 23 | 89.4 cM | wnt1 | Heat Shock (HS) | Woods, Ian G. | Data | 
| Note: Physical map location as
            displayed in the genome browsers is more precise than linkage map location.  Physical map location should be used whenever possible.  | 
    |||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] | 
|---|---|---|---|
| SJD | 1700,2200 | 36.0 | |
| Forward Primer | TGACCAACCTGCACAACAAT | ||
| Reverse Primer | ATCCCGAGATGAAGGGAGTT |