ZFIN ID: ZDB-GENE-980526-531

Mapping Details

Gene Name: retinoic acid receptor gamma a
Symbol: rarga
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 23 38,891,325 - 39,066,506 GRCz12tu
NCBI Map Viewer 23 38,891,325 - 39,066,506 GRCz12tu
Ensembl 23 35,847,200 - 35,963,735 GRCz11
NCBI Map Viewer 23 35,847,200 - 35,965,288 GRCz11
UCSC 23 - GRCz11
Vega 23 35,748,397 - 35,864,932 GRCv10
Mapped Clones containing rarga
DKEY-148F24 Chr: 23 Details
DKEY-43N10 Chr: 23 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa32460 23 39,059,643 GRCz12tu DIRECT Sealy et al., 2025
23 35,959,209 GRCz11 DIRECT Busch-Nentwich et al., 2013
23 35,860,406 GRCz10 DIRECT Busch-Nentwich et al., 2013
23 36,010,753 Zv9 DIRECT Busch-Nentwich et al., 2013
la010912Tg 23 35,992,769 - 35,992,779 Zv9 ZFIN_Zv9 BurgessLin
la014420Tg 23 35,950,008 - 35,950,018 Zv9 ZFIN_Zv9 BurgessLin
la014421Tg 23 35,993,591 - 35,993,601 Zv9 ZFIN_Zv9 BurgessLin
la022698Tg 23 35,977,271 - 35,977,281 Zv9 ZFIN_Zv9 BurgessLin
la022699Tg 23 35,993,556 - 35,993,566 Zv9 ZFIN_Zv9 BurgessLin
la022701Tg 23 35,997,974 - 35,997,984 Zv9 ZFIN_Zv9 BurgessLin
la028558Tg 23 35,982,564 - 35,982,574 Zv9 ZFIN_Zv9 BurgessLin
la028559Tg 23 36,002,569 - 36,002,579 Zv9 ZFIN_Zv9 BurgessLin
la010912Tg 23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
la014420Tg 23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
la014421Tg 23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
la022698Tg 23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
la022699Tg 23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
la022701Tg 23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
la028558Tg 23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
la028559Tg 23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa32460 23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
23 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
23 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
23 125.1 cM rarg Mother of Pearl (MOP) Postlethwait, John H. Data
23 434.81 cR rarg Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
23 5391.0 cR rarg Goodfellow T51 (T51) Geisler, Robert Data
23 108.7 cM rarg Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by rarga
fb01e02 Chr: 23 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 624 36.0
Forward Primer GGGCCATAACTCTGAAGATG
Reverse Primer GAACCCGTTGAAAGTACACTG
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.