| ZFIN ID: ZDB-SSLP-980528-1340 |
| SSLP: | z10122 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 12 | 6.3 cM | z10122 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 12 | 57.94 cR | Z10122 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 12 | 189.0 cR | z10122 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z7135 | SSLP | 12 | Bland, 2001 | Bland (2001) mapped bmp9 (gdf2) onto the LN54 panel between z7135 and zl0l22 ... | |
| gdf2 | GENE | 12 | Bland, 2001 | Bland (2001) mapped bmp9 (gdf2) onto the LN54 panel between z7135 and zl0l22 ... | |
| z1473 | SSLP | 12 | Lyons et al., 2005 | Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb2 to LG12 using bulk segregant analysis. | |
| st61 | Feature | 12 | 16.7 cM | Lyons et al., 2005 | Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb2 to LG12 using bulk segregant analysis. |
| st50 | Feature | 12 | Lyons et al., 2005 | Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb2 to LG12 using bulk segregant analysis. | |
| z8460 | SSLP | 12 | Lyons et al., 2005 | Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb2 to LG12 using bulk segregant analysis. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 0,218 | 60.0 | |
| Forward Primer | AATTGTGGCACAACTGGACA | ||
| Reverse Primer | GCAGAGAATTAGCGGGTTTG | ||
| IND | 0,316 | 60.0 | |
| Forward Primer | AATTGTGGCACAACTGGACA | ||
| Reverse Primer | GCAGAGAATTAGCGGGTTTG | ||
| EKW | 0,254 | 60.0 | |
| Forward Primer | AATTGTGGCACAACTGGACA | ||
| Reverse Primer | GCAGAGAATTAGCGGGTTTG | ||
| TU | 0,218 | 60.0 | |
| Forward Primer | AATTGTGGCACAACTGGACA | ||
| Reverse Primer | GCAGAGAATTAGCGGGTTTG |