| ZFIN ID: ZDB-SSLP-980528-1457 |
| SSLP: | z10960 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 21 | 38.4 cM | z10960 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 21 | 264.75 cR | Z10960 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 21 | 2665.0 cR | z10960 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 21 | 90.8 cM | z10960 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z4425 | SSLP | 21 | Starr et al., 2004 | Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype ... | |
| chm | GENE | 21 | Starr et al., 2004 | Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype ... | |
| dacha | GENE | 21 | Starr et al., 2004 | Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype ... |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 170 | 60.0 | |
| Forward Primer | TCCCCGCTGAGTCCTCTATA | ||
| Reverse Primer | AGTGTGCGAGGTGTGTCAAG | ||
| IND | 160,146 | 60.0 | |
| Forward Primer | TCCCCGCTGAGTCCTCTATA | ||
| Reverse Primer | AGTGTGCGAGGTGTGTCAAG | ||
| TU | 160,146 | 60.0 | |
| Forward Primer | TCCCCGCTGAGTCCTCTATA | ||
| Reverse Primer | AGTGTGCGAGGTGTGTCAAG | ||
| EKW | 170,0,182 | 60.0 | |
| Forward Primer | TCCCCGCTGAGTCCTCTATA | ||
| Reverse Primer | AGTGTGCGAGGTGTGTCAAG |