| ZFIN ID: ZDB-SSLP-980528-422 |
| SSLP: | z3816 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 19 | 47.3 cM | z3816 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 19 | 4569.0 cR | z3816 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 19 | 66.6 cM | z3816 | Heat Shock (HS) | Woods, Ian G. | Data |
| 19 | 38.25 cM | Gates et al (GAT) | Talbot, William S. | Data | |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z11989 | SSLP | 19 | Bolli et al., 2011 | Boli, N. et al. (2011, Blood. 117(5):3996-4007) mapped zdf18a12 to cpsf1 using bulk segregant analysis and molecular analysis. | |
| cpsf1 | GENE | 19 | Bolli et al., 2011 | Boli, N. et al. (2011, Blood. 117(5):3996-4007) mapped zdf18a12 to cpsf1 using bulk segregant analysis and molecular analysis. | |
| zdfI8a12 | Feature | 19 | Bolli et al., 2011 | Boli, N. et al. (2011, Blood. 117(5):3996-4007) mapped zdf18a12 to cpsf1 using bulk segregant analysis and molecular analysis. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | NA | ||
| Forward Primer | AGATCAGGTGCACAGTGGCG | ||
| Reverse Primer | CCACTGAAGGGCAAGTGGCT | ||
| AB | NA | ||
| Forward Primer | AGATCAGGTGCACAGTGGCG | ||
| Reverse Primer | CCACTGAAGGGCAAGTGGCT |