| ZFIN ID: ZDB-SSLP-980528-588 |
| SSLP: | z5395 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 13 | 40.0 cM | z5395 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 13 | 68.8 cM | z5395 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 13 | 266.3 cR | Z5395 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 13 | 43.0 cM | z5395 | Heat Shock (HS) | Woods, Ian G. | Data |
| 13 | 25.67 cM | Gates et al (GAT) | Talbot, William S. | Data | |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z25745 | SSLP | 13 | Koudijs et al., 2005 | ||
| tm146d | Feature | 13 | 0.6 cM | Koudijs et al., 2005 | |
| z13250 | SSLP | 13 | Schorpp et al., 2006 | Schorpp et al. (2006, J. Immunol. 177(4):2463-2476) mapped t24980 to Chr. 13. | |
| t24980 | Feature | 13 | Schorpp et al., 2006 | Schorpp et al. (2006, J. Immunol. 177(4):2463-2476) mapped t24980 to Chr. 13. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | NA | ||
| Forward Primer | CAGCCCCCTCAGTCACGACT | ||
| Reverse Primer | CGCGCCCTCTCTGAGAACAT | ||
| AB | NA | ||
| Forward Primer | CAGCCCCCTCAGTCACGACT | ||
| Reverse Primer | CGCGCCCTCTCTGAGAACAT |