| CRISPR Name: | CRISPR1-furina | 
    
        
        | Target: | furina  (1) | 
    
    
        
            | Source: |  | 
    
    
        | Target Sequence: | 
                        5' - GGGTATTCAGACGAACCCCAGA - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | The first two "G"s were added. The PAM site was "AGG" at the 3' end.
ZDB-CRISPR-241122-1 and ZDB-CRISPR-241122-2 were designed to be applied together in order to delete a 1.3 kb region in the 3'-UTR of a variant transcript of furina. The deleted region contains the YBE (Ybx1 binding element). |