| Morpholino Name: | MO3-tbxta | 
    
        
        | Target: | tbxta  (1) | 
    
        
    
        
    
    
    | Previous Names: | MO3-ntl, 
            
                MO3-ta | 
    | 
    
        Attributions for Alias: {{control.newAlias}}
     
    
        Delete Alias: 
        
    
    (Including Attributions)
    
 | 
    
    
    
        | Sequence: | 
                        5' - GACTTGAGGCAGACATATTTCCGAT - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | Published as a photoactivatable morpholino. A photo-cleavable version of this MO was described in Tallafuss et al. 2012 (ZDB-PUB-120412-12). MO nucleotide 13 (A) was replaced by a photo-sensitive subunit. A caged version of this morpholino was described in Darrah et al., 2021( ZDB-PUB-211028-5). A self-transfecting guanidinium linked morpholino (GMO) was described in Das et al., 2023 ZDB-PUB-230420-69. |