| Morpholino Name: | 
        MO4-ret | 
    
    
        
        | Target:
         | 
        
            
                    
                        ret  (1)
                    
            
         | 
    
    
        
    
        
    
    
    | 
        Previous Names:
        
     | 
    
            
            
                MO4-ret1, 
            
                ret51Sp (1)
            
                
        
     | 
    
        
    
        Attributions for Alias: {{control.newAlias}}
    
    
    
 
    
        Delete Alias: 
        
    
    (Including Attributions)
    
  
     | 
    
    
    
        | 
            Sequence:
         | 
        
            
                
                     
                        5' - TGACATGCCTAAAAACGAGAACATA - 3'
                        
                     
                    
                
                
            
         | 
    
    
    
        |   | 
        
            
                
                    (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.)
                
            
         | 
    
    
    
        | Note: | 
        Splice blocking morpholino that specifically targets the exon 19-intron 19 boundary; the "Ret51" isoform of ret1 is not produced. |