| Morpholino Name: | MO2-nkx2.4a | 
    
        
        | Target: | nkx2.4a  (1) | 
    
    
    
        | Sequence: | 
                        5' - GCTCAGCGACATGGTTCAGCCCGCA - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | Translation-blocking morpholino. The author was contacted and verified the sequence of this morpholino, the sequence of this morpholino differs from that found in Ensembl. |