CRISPR

CRISPR1-kcnb1

ID
ZDB-CRISPR-170106-1
Name
CRISPR1-kcnb1
Previous Names
None
Target
Sequence
5' - GGAGCTGGACTACTGGGGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sq301 kcnb1
Expression
Gene expression in Wild Types + CRISPR1-kcnb1
No data available
Phenotype
Phenotype resulting from CRISPR1-kcnb1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-kcnb1
Phenotype Fish Conditions Figures
swimming decreased linear velocity, abnormal kcnb1sq301/sq301 lighting conditions Fig. 3 with image from Robichon et al., 2025
head glutamic acid normal amount, abnormal kcnb1sq301/sq301 standard conditions Fig. 5 with image from Robichon et al., 2025
whole organism kcnb1 expression decreased amount, abnormal kcnb1sq301/sq301 standard conditions Fig. 2 with image from Robichon et al., 2025
swimming decreased linear velocity, abnormal kcnb1sq301/sq301 acoustic radiation Fig. 3 with image from Robichon et al., 2025
tectal ventricle decreased size, abnormal kcnb1sq301/sq301 standard conditions Fig. 7 with image from Shen et al., 2016
swimming behavior disrupted, abnormal kcnb1sq301/sq301 lighting conditions Fig. 3 with image from Robichon et al., 2025
response to auditory stimulus decreased magnitude, abnormal kcnb1sq301/sq301 acoustic radiation Fig. 3 with image from Robichon et al., 2025
neuronal action potential increased frequency, exacerbated kcnb1sq301/sq301 chemical treatment by environment: pentetrazol Fig. 5 with image from Robichon et al., 2025
neuronal action potential increased frequency, abnormal kcnb1sq301/sq301 standard conditions Fig. 5 with image from Robichon et al., 2025
swimming increased linear velocity, abnormal kcnb1sq301/sq301 standard conditions Fig. 3 with imageFig. 4 with image from Robichon et al., 2025
epiboly delayed, abnormal kcnb1sq301/sq301 standard conditions Fig. S8 with image from Shen et al., 2016
brain ventricular system decreased size, abnormal kcnb1sq301/sq301 standard conditions Fig. 7 with image from Shen et al., 2016
fourth ventricle decreased size, abnormal kcnb1sq301/sq301 standard conditions Fig. 7 with image from Shen et al., 2016
whole organism bdnf expression increased amount, abnormal kcnb1sq301/sq301 standard conditions Fig. 4 with image from Robichon et al., 2025
swimming increased frequency, abnormal kcnb1sq301/sq301 standard conditions Fig. 3 with image from Robichon et al., 2025
head glutamic acid normal amount, abnormal kcnb1sq301/sq301 chemical treatment by environment: pentetrazol Fig. 5 with image from Robichon et al., 2025
head gamma-aminobutyric acid increased amount, abnormal kcnb1sq301/sq301 standard conditions Fig. 5 with image from Robichon et al., 2025
swimming behavior disrupted, abnormal kcnb1sq301/sq301 standard conditions Fig. 3 with image from Robichon et al., 2025
gastrulation disrupted, abnormal kcnb1sq301/sq301 standard conditions Fig. S8 with image from Shen et al., 2016
head gamma-aminobutyric acid increased amount, abnormal kcnb1sq301/sq301 chemical treatment by environment: pentetrazol Fig. 5 with image from Robichon et al., 2025
otolith increased amount, abnormal kcnb1sq301/sq301 (AB) standard conditions Fig. S1 from Jędrychowska et al., 2024
otic vesicle increased size, abnormal kcnb1sq301/sq301 (AB) standard conditions Fig. S1 from Jędrychowska et al., 2024
head glutamic acid normal amount, abnormal kcnb1sq301/+ chemical treatment by environment: pentetrazol Fig. 5 with image from Robichon et al., 2025
whole organism kcnb1 expression decreased amount, abnormal kcnb1sq301/+ standard conditions Fig. 2 with image from Robichon et al., 2025
neuronal action potential increased duration, abnormal kcnb1sq301/+ chemical treatment by environment: pentetrazol Fig. 5 with image from Robichon et al., 2025
swimming increased linear velocity, abnormal kcnb1sq301/+ standard conditions Fig. 3 with imageFig. 4 with image from Robichon et al., 2025
neuronal action potential increased frequency, abnormal kcnb1sq301/+ chemical treatment by environment: pentetrazol Fig. 5 with image from Robichon et al., 2025
swimming increased frequency, abnormal kcnb1sq301/+ standard conditions Fig. 3 with image from Robichon et al., 2025
swimming behavior disrupted, abnormal kcnb1sq301/+ standard conditions Fig. 3 with image from Robichon et al., 2025
Citations