CRISPR

CRISPR1-ldlra

ID
ZDB-CRISPR-170913-2
Name
CRISPR1-ldlra
Previous Names
None
Target
Sequence
5' - GGTTGCACTGCCGACTGCCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sd52 ldlra
Expression
Gene expression in Wild Types + CRISPR1-ldlra
No data available
Phenotype
Phenotype resulting from CRISPR1-ldlra
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ldlra
Phenotype Fish Conditions Figures
liver hmgcra expression increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 2 from Liu et al., 2017
vasculature lipid increased amount, abnormal ldlrasd52/sd52 high cholesterol Fig. 5 from Liu et al., 2017
whole organism hmgcra expression increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 3 from Liu et al., 2017
vasculature lipid amount, ameliorated ldlrasd52/sd52 high cholesterol, chemical treatment by diet: lomitapide Fig. 5 from Liu et al., 2017
blood coagulation increased occurrence, exacerbated ldlrasd52/sd52 chemical treatment by environment: alvespimycin, chemical treatment by environment: iron trichloride Fig. 6 with image from Kaveh et al., 2026
whole organism triglyceride increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 3 from Liu et al., 2017
vasculature lipid increased amount, abnormal ldlrasd52/sd52 high cholesterol, chemical treatment by diet: probucol Fig. 5 from Liu et al., 2017
caudal vein lipid increased amount, abnormal ldlrasd52/sd52 high cholesterol Fig. 4 from Liu et al., 2017
tolerance induction to lipopolysaccharide disrupted, abnormal ldlrasd52/sd52 chemical treatment by injection: lipopolysaccharide Fig. S3 from Liu et al., 2017
vasculature lipid increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 3 from Liu et al., 2017
blood plasma lipid amount, ameliorated ldlrasd52/sd52 high cholesterol, chemical treatment by diet: lomitapide Fig. 5 from Liu et al., 2017
whole organism fasn expression increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 3 from Liu et al., 2017
blood plasma lipid increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 5 from Liu et al., 2017
hepatocyte cellular response to lipopolysaccharide disrupted, abnormal ldlrasd52/sd52 chemical treatment by injection: lipopolysaccharide Fig. 6 from Liu et al., 2017
whole organism ldlra expression decreased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 3 from Liu et al., 2017
whole organism cholesterol increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 3 from Liu et al., 2017
blood plasma very-low-density lipoprotein decreased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 2 from Liu et al., 2017
blood plasma low-density lipoprotein increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 2 from Liu et al., 2017
liver ldlra expression decreased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 2 from Liu et al., 2017
blood plasma cholesterol increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 2 from Liu et al., 2017
blood coagulation increased occurrence, abnormal ldlrasd52/sd52 chemical treatment by environment: iron trichloride Fig. 6 with image from Kaveh et al., 2026
blood plasma lipid increased amount, abnormal ldlrasd52/sd52 high cholesterol Fig. 5 from Liu et al., 2017
blood plasma lipid increased amount, abnormal ldlrasd52/sd52 high cholesterol, chemical treatment by diet: probucol Fig. 5 from Liu et al., 2017
caudal vein lipid increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 4 from Liu et al., 2017
blood plasma triglyceride increased amount, abnormal ldlrasd52/sd52 standard conditions Fig. 2 from Liu et al., 2017
whole organism low-density lipoprotein particle decreased size, abnormal ldlrasd52/sd52 (AB) standard conditions Fig. 5 with image from Sweeney et al., 2025
regenerating fin neutrophil EGFP expression increased amount, abnormal ldlrasd52/sd52; i114Tg/i114Tg amputation: caudal fin Fig. 6 with image from Kaveh et al., 2026
caudal hematopoietic tissue neutrophil EGFP expression increased amount, abnormal ldlrasd52/sd52; i114Tg/i114Tg standard conditions Fig. 6 with image from Kaveh et al., 2026
caudal hematopoietic tissue neutrophil EGFP expression increased amount, abnormal ldlrasd52/sd52; i114Tg/i114Tg chemical treatment by environment: alvespimycin Fig. 6 with image from Kaveh et al., 2026
regenerating fin neutrophil chemotaxis increased occurrence, abnormal ldlrasd52/sd52; i114Tg/i114Tg amputation: caudal fin Fig. 6 with image from Kaveh et al., 2026
endothelial cell cellular response to stress increased occurrence, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image,  Fig. 3 with image from Kaveh et al., 2026
endothelial cell hsp70l expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 3 with image from Kaveh et al., 2026
whole organism hspa5 expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
trunk endothelial cell hsp70l expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
caudal vein plexus cilium decreased length, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 1 with image from Kaveh et al., 2026
trunk vasculature apoptotic process increased occurrence, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 1 with image from Kaveh et al., 2026
endothelial cell dnajb1b expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 3 with image from Kaveh et al., 2026
intersegmental vessel hsp70l expression increased distribution, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
whole organism ddit3 expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
whole organism atf4a expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
caudal vein plexus cilium ab1-tuba labeling decreased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg chemical treatment by environment: alvespimycin Fig. 5 with image from Kaveh et al., 2026
caudal vein plexus hsp70l expression increased distribution, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
caudal vein plexus tube morphogenesis decreased process quality, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 1 with image from Kaveh et al., 2026
intersegmental vessel regeneration decreased process quality, abnormal ldlrasd52/sd52; s843Tg/s843Tg amputation: caudal fin Fig. 6 with image from Kaveh et al., 2026
caudal vein plexus EGFP expression spatial pattern, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 5 with image from Kaveh et al., 2026
trunk vasculature apoptotic process increased occurrence, abnormal ldlrasd52/sd52; s843Tg/s843Tg chemical treatment by environment: 4-[[(2R,3S,4R,5R)-5-[6-amino-8-[(3,4-dichlorophenyl)methylamino]-9-purinyl]-3,4-dihydroxy-2-oxolanyl]methoxymethyl]benzonitrile Fig. 5 with image from Kaveh et al., 2026
trunk vasculature apoptotic process increased occurrence, ameliorated ldlrasd52/sd52; s843Tg/s843Tg chemical treatment by environment: alvespimycin Fig. 5 with image from Kaveh et al., 2026
dorsal aorta hsp70l expression increased distribution, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
endothelial cell hsp70l expression amount, ameliorated ldlrasd52/sd52; s843Tg/s843Tg chemical treatment by environment: diacetylmonoxime Fig. 3 with image from Kaveh et al., 2026
caudal vein plexus cilium ab1-tuba labeling amount, ameliorated ldlrasd52/sd52; s843Tg/s843Tg chemical treatment by environment: 4-[[(2R,3S,4R,5R)-5-[6-amino-8-[(3,4-dichlorophenyl)methylamino]-9-purinyl]-3,4-dihydroxy-2-oxolanyl]methoxymethyl]benzonitrile Fig. 5 with image from Kaveh et al., 2026
whole organism dnajb1b expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
caudal vein plexus EGFP expression spatial pattern, abnormal ldlrasd52/sd52; s843Tg/s843Tg chemical treatment by environment: 4-[[(2R,3S,4R,5R)-5-[6-amino-8-[(3,4-dichlorophenyl)methylamino]-9-purinyl]-3,4-dihydroxy-2-oxolanyl]methoxymethyl]benzonitrile Fig. 5 with image from Kaveh et al., 2026
caudal vein plexus cilium ab1-tuba labeling decreased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 1 with image,  Fig. 5 with image from Kaveh et al., 2026
dorsal longitudinal anastomotic vessel hsp70l expression increased distribution, abnormal ldlrasd52/sd52; s843Tg/s843Tg standard conditions Fig. 2 with image from Kaveh et al., 2026
caudal vein plexus EGFP expression spatial pattern, ameliorated ldlrasd52/sd52; s843Tg/s843Tg chemical treatment by environment: alvespimycin Fig. 5 with image from Kaveh et al., 2026
intersegmental vessel EGFP expression spatial pattern, abnormal ldlrasd52/sd52; s843Tg/s843Tg amputation: caudal fin Fig. 6 with image from Kaveh et al., 2026
caudal vein plexus blood cell DsRed expression spatial pattern, abnormal ldlrasd52/sd52; sd2Tg/sd2Tg standard conditions Fig. 1 with image from Kaveh et al., 2026
caudal vein plexus blood cell increased velocity, abnormal ldlrasd52/sd52; sd2Tg/sd2Tg standard conditions Fig. 1 with image from Kaveh et al., 2026
caudal hematopoietic tissue macrophage Tomato expression increased amount, abnormal ldlrasd52/sd52; xt12Tg/xt12Tg standard conditions Fig. 6 with image from Kaveh et al., 2026
trunk vasculature apoptotic process increased occurrence, abnormal ldlrasd52/sd52; s843Tg/s843Tg + CRISPR4-hsp70l standard conditions Fig. 5 with image from Kaveh et al., 2026
endothelial cell hsp70l expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Kaveh et al., 2026
caudal vein plexus EGFP expression spatial pattern, abnormal ldlrasd52/sd52; s843Tg/s843Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Kaveh et al., 2026
blood circulation decreased rate, abnormal ldlrasd52/sd52; s843Tg/s843Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Kaveh et al., 2026
endothelial cell dnajb1b expression increased amount, abnormal ldlrasd52/sd52; s843Tg/s843Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Kaveh et al., 2026
endothelial cell cellular response to stress increased occurrence, abnormal ldlrasd52/sd52; s843Tg/s843Tg + MO1-tnnt2a standard conditions Fig. 3 with image from Kaveh et al., 2026
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.