CRISPR

CRISPR1-cln8

ID
ZDB-CRISPR-250108-1
Name
CRISPR1-cln8
Previous Names
None
Target
Sequence
5' - GGTTTGCAGGGGCGGTTGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
irc2 cln8
Expression
Gene expression in Wild Types + CRISPR1-cln8
No data available
Phenotype
Phenotype resulting from CRISPR1-cln8
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cln8
Phenotype Fish Conditions Figures
locomotory exploration behavior increased process quality, abnormal cln8irc2/irc2 (AB) standard conditions Figure 2 with image from Licitra et al., 2025
social behavior decreased process quality, abnormal cln8irc2/irc2 (AB) chemical treatment by diet: trehalose Figure 3 with image from Licitra et al., 2025
cognition decreased process quality, abnormal cln8irc2/irc2 (AB) chemical treatment by diet: trehalose Figure 7 with image from Licitra et al., 2025
social behavior process quality, ameliorated cln8irc2/irc2 (AB) chemical treatment by diet: trehalose Figure 4 with image from Licitra et al., 2025
aggressive behavior increased process quality, abnormal cln8irc2/irc2 (AB) standard conditions Figure 5 with imageFigure 6 with image from Licitra et al., 2025
aggressive behavior process quality, ameliorated cln8irc2/irc2 (AB) chemical treatment by diet: trehalose Figure 5 with imageFigure 6 with image from Licitra et al., 2025
social behavior decreased process quality, abnormal cln8irc2/irc2 (AB) standard conditions Figure 3 with imageFigure 4 with image from Licitra et al., 2025
locomotory exploration behavior process quality, ameliorated cln8irc2/irc2 (AB) chemical treatment by diet: trehalose Figure 2 with image from Licitra et al., 2025
cognition decreased process quality, abnormal cln8irc2/irc2 (AB) standard conditions Figure 7 with image from Licitra et al., 2025
locomotion increased process quality, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 2 with imageFig. 7 with image from Marchese et al., 2024
swimming behavior decreased process quality, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: 1-methyl-3-oxo-1,3-dihydro-2,1-benzothiazole-5-sulfonamide Fig. 7 with image from Marchese et al., 2024
whole organism map1lc3b expression increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 6 with image from Marchese et al., 2024
locomotion process quality, ameliorated mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 7 with image from Marchese et al., 2024
trunk lysosomal lumen pH elevation increased process quality, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 3 with image from Marchese et al., 2024
whole organism hif1ab expression decreased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 6 with imageFig. 8 with image from Marchese et al., 2024
trunk Ab1-atp5 labeling increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 3 with image from Marchese et al., 2024
whole organism ab2-map1lc3 labeling increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 6 with imageFig. 8 with image from Marchese et al., 2024
whole organism Ab2-ctsd labeling increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: 1-methyl-3-oxo-1,3-dihydro-2,1-benzothiazole-5-sulfonamide Fig. 8 with image from Marchese et al., 2024
swimming behavior decreased process quality, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 2 with imageFig. 7 with image from Marchese et al., 2024
swimming behavior decreased process quality, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 7 with image from Marchese et al., 2024
whole organism tnfa expression increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 5 with image from Marchese et al., 2024
yolk increased area, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 1 with image from Marchese et al., 2024
eye decreased size, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 1 with image from Marchese et al., 2024
whole organism Ab4-rab7 labeling increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: 1-methyl-3-oxo-1,3-dihydro-2,1-benzothiazole-5-sulfonamide Fig. 8 with image from Marchese et al., 2024
whole organism becn1 expression increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 6 with image from Marchese et al., 2024
whole organism il1b expression increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 5 with image from Marchese et al., 2024
whole organism ab2-map1lc3 labeling amount, ameliorated mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: 1-methyl-3-oxo-1,3-dihydro-2,1-benzothiazole-5-sulfonamide Fig. 8 with image from Marchese et al., 2024
whole organism cln8 expression decreased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 1 with image from Marchese et al., 2024
whole organism mtor expression increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 6 with image from Marchese et al., 2024
whole organism hif1ab expression amount, ameliorated mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 8 with image from Marchese et al., 2024
whole organism ab2-map1lc3 labeling increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 8 with image from Marchese et al., 2024
head lipid increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 3 with image from Marchese et al., 2024
whole organism Ab4-rab7 labeling increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 6 with imageFig. 8 with image from Marchese et al., 2024
whole organism atg5 expression increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 6 with image from Marchese et al., 2024
whole organism increased length, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 1 with image from Marchese et al., 2024
whole organism hif1ab expression amount, ameliorated mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: 1-methyl-3-oxo-1,3-dihydro-2,1-benzothiazole-5-sulfonamide Fig. 8 with image from Marchese et al., 2024
brain lysosomal lumen pH elevation increased process quality, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 3 with image from Marchese et al., 2024
whole organism Ab2-ctsd labeling amount, ameliorated mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 8 with image from Marchese et al., 2024
brain apoptotic process increased process quality, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 3 with image from Marchese et al., 2024
whole organism Ab2-ctsd labeling increased amount, abnormal mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 6 with imageFig. 8 with image from Marchese et al., 2024
whole organism Ab4-rab7 labeling amount, ameliorated mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 8 with image from Marchese et al., 2024
locomotion process quality, ameliorated mitfaw2/+; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: 1-methyl-3-oxo-1,3-dihydro-2,1-benzothiazole-5-sulfonamide Fig. 7 with image from Marchese et al., 2024
brain action potential initiation increased duration, abnormal mitfaw2/w2; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 4 with imageFig. 7 with image from Marchese et al., 2024
brain action potential initiation process quality, ameliorated mitfaw2/w2; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: 1-methyl-3-oxo-1,3-dihydro-2,1-benzothiazole-5-sulfonamide Fig. 7 with image from Marchese et al., 2024
brain action potential initiation process quality, ameliorated mitfaw2/w2; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 7 with image from Marchese et al., 2024
brain action potential initiation increased duration, abnormal mitfaw2/w2; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 7 with image from Marchese et al., 2024
brain action potential initiation increased process quality, abnormal mitfaw2/w2; cln8irc2/irc2; icm05Tg (AB) standard conditions Fig. 4 with imageFig. 7 with image from Marchese et al., 2024
brain action potential initiation duration, ameliorated mitfaw2/w2; cln8irc2/irc2; icm05Tg (AB) chemical treatment by environment: 1-methyl-3-oxo-1,3-dihydro-2,1-benzothiazole-5-sulfonamide Fig. 7 with image from Marchese et al., 2024
Citations