CRISPR

CRISPR1-ddr2a

ID
ZDB-CRISPR-260813-1
Name
CRISPR1-ddr2a
Previous Names
None
Target
Sequence
5' - GGGCATGAATCGGACGAAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-ddr2a
No data available
Phenotype
Phenotype resulting from CRISPR1-ddr2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ddr2a
Phenotype Fish Conditions Figures
whole organism fgg expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism itln2 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism f7i expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism angptl3 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism agt expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
palatoquadrate cartilage malformed, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
palatoquadrate cartilage Ab6-col2a1 labeling increased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
palatoquadrate cartilage Ab6-col2a1 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
whole organism prss1 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism ecm1a expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism s100a10a expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism he1.1 expression increased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism serpinh1b expression increased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism c1qtnf9 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism mbl2 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism adamts13 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism fga expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism serpina1 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism cela1.6 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism ebi3 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism mep1a.2 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
sternohyoid Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
whole organism itih3b.1 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism ctslb expression increased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
interhyal cartilage Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
whole organism serpinf2a expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
hyohyoideus Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
whole organism ctsbb expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism ins expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
hyohyoideus Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage Ab6-col2a1 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
whole organism lgals2b expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism tmprss15 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
sternohyoid Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
interhyal cartilage Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage shortened, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
whole organism prg4b expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism anxa2b expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
extracellular matrix assembly increased occurrence, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
ethmoid cartilage Ab6-col2a1 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
whole organism he1.2 expression increased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism mep1a.1 expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
whole organism fgb expression decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 6 with image from Capecki et al., 2026
cranial skeletal system development decreased process quality, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a standard conditions Figure 3 with image from Capecki et al., 2026
palatoquadrate cartilage Ab6-col2a1 labeling increased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
palatoquadrate cartilage malformed, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
palatoquadrate cartilage Ab6-col2a1 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
sternohyoid Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
interhyal cartilage Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
hyohyoideus Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
hyohyoideus Ab1-ddr2 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage Ab6-col2a1 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
sternohyoid Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
interhyal cartilage Ab1-ddr2 labeling spatial pattern, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage shortened, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
ethmoid cartilage Ab6-col2a1 labeling decreased amount, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 4 with image from Capecki et al., 2026
cranial skeletal system development decreased process quality, abnormal WT + CRISPR1-ddr2a + CRISPR2-ddr2a + CRISPR3-ddr2a + CRISPR4-ddr2a + CRISPR5-ddr2a + MO1-ddr2a standard conditions Figure 3 with image from Capecki et al., 2026
Citations