Morpholino

MO1-prkcz

ID
ZDB-MRPHLNO-070511-1
Name
MO1-prkcz
Previous Names
None
Target
Sequence
5' - GATCCGTTACTGACAGGCATTATA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prkcz
No data available
Phenotype
Phenotype resulting from MO1-prkcz
Phenotype of all Fish created by or utilizing MO1-prkcz
Phenotype Fish Conditions Figures
intersegmental vessel malformed, abnormal y1Tg + MO1-prkcz standard conditions Fig. 6 from Oubaha et al., 2012
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-prkcz standard conditions Fig. 6 from Oubaha et al., 2012
intersegmental vessel sprouting angiogenesis process quality, abnormal y1Tg + MO1-prkcz standard conditions Fig. 6 from Oubaha et al., 2012
intersegmental vessel endothelial tip cell detached from dorsal aorta, abnormal y1Tg + MO1-prkcz standard conditions Fig. 6 from Oubaha et al., 2012
intersegmental vessel has extra parts of type endothelial tip cell filopodium, abnormal y1Tg + MO1-prkcz standard conditions Fig. 6 from Oubaha et al., 2012
nuclear migration disrupted, abnormal knu3Tg/knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 6 from Baye et al., 2007
neuroblast nucleus position, abnormal knu3Tg/knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 6 from Baye et al., 2007
neuroblast development disrupted, abnormal knu3Tg/knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 6 from Baye et al., 2007
pigmented epithelial cell pigment granule mislocalised, abnormal prkcim567/m567 + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
retina structure, abnormal prkcim567/m567 + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
pigmented epithelial cell shape, abnormal prkcim567/m567 + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 12 with image from Krock et al., 2014
camera-type eye photoreceptor cell differentiation arrested, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 8 with image from Krock et al., 2014
retina lacks all parts of type retinal cone cell, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 8 with image from Krock et al., 2014
camera-type eye photoreceptor cell differentiation decreased occurrence, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 9 with image from Krock et al., 2014
retina has fewer parts of type retinal rod cell, abnormal AB/EKW + MO1-prkci + MO1-prkcz standard conditions Fig. 9 with image from Krock et al., 2014
heart edematous, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 6 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule malformed, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 5 with image from Gerlach et al., 2014
pronephros pronephric nephron tubule epithelial cell differentiation process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 7 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule endocytosis decreased occurrence, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 6 with image from Gerlach et al., 2014
renal filtration decreased occurrence, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 6 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule apoptotic, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 5 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule apoptotic process increased occurrence, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 5 with image from Gerlach et al., 2014
pronephric glomerulus development process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 7 with image from Gerlach et al., 2014
pronephric proximal convoluted tubule cell differentiation process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 8 with image,  Fig. 9 with image from Gerlach et al., 2014
pronephric proximal straight tubule cell differentiation process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 8 with image from Gerlach et al., 2014
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 5 with image from Gerlach et al., 2014
pronephric tubule establishment of epithelial cell apical/basal polarity decreased occurrence, abnormal TU + MO1-prkci + MO1-prkcz standard conditions Fig. 3 with image from Gerlach et al., 2014
pigmented epithelial cell shape, abnormal WT + MO1-prkci + MO1-prkcz standard conditions Fig. 2 from Cui et al., 2007
pigmented epithelial cell pigment granule mislocalised, abnormal WT + MO1-prkci + MO1-prkcz standard conditions Fig. 2 from Cui et al., 2007
mitotic cell cycle process quality, abnormal WT + MO1-prkci + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
retinal ganglion cell layer disorganized, abnormal knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
cell migration process quality, abnormal knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 9 from Cui et al., 2007
retina cellular quality, abnormal knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 9 from Cui et al., 2007
amacrine cell spatial pattern, abnormal knu3Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 3 from Cui et al., 2007
pronephros establishment of epithelial cell apical/basal polarity decreased occurrence, abnormal nz1Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 4 with image from Gerlach et al., 2014
pronephric nephron tubule morphogenesis decreased process quality, abnormal nz1Tg + MO1-prkci + MO1-prkcz standard conditions Fig. 4 with image from Gerlach et al., 2014
retina neuroepithelial cell positional polarity, abnormal kca66Tg; kca6Tg + MO1-prkci + MO1-prkcz (AB) standard conditions Fig. 3 from Cui et al., 2007
Citations