Morpholino

MO3-bmp4

ID
ZDB-MRPHLNO-070710-1
Name
MO3-bmp4
Previous Names
None
Target
Sequence
5' - GGTGTTTGATTGTCTGACCTTCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
e1-e2 splice blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bmp4
No data available
Phenotype
Phenotype resulting from MO3-bmp4
Phenotype of all Fish created by or utilizing MO3-bmp4
Phenotype Fish Conditions Figures
caudal fin decreased size, abnormal WT + MO1-bmp4 + MO3-bmp4 standard conditions Fig. S2 with image from Smith et al., 2008
whole organism wholly dorsalized, abnormal WT + MO3-bmp4 standard conditions Fig. 5 with image from Chocron et al., 2007
liver duplicated, abnormal WT + MO3-bmp4 standard conditions Fig. 6 with image from Chocron et al., 2007
gut decreased curvature, abnormal WT + MO3-bmp4 standard conditions Fig. 6 with image from Chocron et al., 2007
notochord development disrupted, abnormal WT + MO3-bmp4 standard conditions Fig. 3 with image,  Fig. 4 with image from Esterberg et al., 2008
atrium position, abnormal WT + MO3-bmp4 standard conditions Fig. 6 with image from Chocron et al., 2007
notochord development peramorphic growth, abnormal WT + MO3-bmp4 standard conditions Fig. 5 with image,  Fig. 6 with image from Esterberg et al., 2008
notochord cell decreased amount, abnormal WT + MO3-bmp4 standard conditions Fig. 3 with image from Esterberg et al., 2008
notochord cell vacuolated, abnormal WT + MO3-bmp4 standard conditions Fig. 6 with image from Esterberg et al., 2008
determination of left/right symmetry process characteristic, abnormal WT + MO3-bmp4 standard conditions Fig. 6 with image from Chocron et al., 2007
notochord decreased diameter, abnormal WT + MO3-bmp4 standard conditions Fig. 3 with image from Esterberg et al., 2008
cell population proliferation disrupted, abnormal WT + MO3-bmp4 standard conditions Fig. 4 with image from Esterberg et al., 2008
axial chorda mesoderm decreased size, abnormal WT + MO3-bmp4 standard conditions Fig. 2 with image from Esterberg et al., 2008
chordo neural hinge decreased size, abnormal WT + MO3-bmp4 standard conditions Fig. 3 with image from Esterberg et al., 2008
pancreas duplicated, abnormal WT + MO3-bmp4 standard conditions Fig. 6 with image from Chocron et al., 2007
heart looping disrupted, abnormal WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4 standard conditions Fig. S2 with image from Smith et al., 2008
pericardium edematous, abnormal WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4 standard conditions Fig. S2 with image from Smith et al., 2008
caudal fin decreased size, abnormal WT + MO1-bmp4 + MO1-has2 + MO2-has2 + MO3-bmp4 standard conditions Fig. S2 with image from Smith et al., 2008
axial chorda mesoderm decreased size, abnormal WT + MO2-fstl1a + MO3-bmp4 + MO4-fstl1b standard conditions Fig. 2 with image from Esterberg et al., 2008
presumptive endocardium heart development decreased process quality, abnormal twu34Tg + MO3-bmp4 + MO3-spaw standard conditions Fig. 3 with image from Lenhart et al., 2013
embryonic heart tube left/right pattern formation process characteristic, abnormal twu34Tg + MO3-bmp4 + MO3-spaw standard conditions Fig. 1 with image from Lenhart et al., 2013
heart rudiment cardioblast anterior-lateral migration process characteristic, abnormal twu34Tg + MO3-bmp4 + MO3-spaw standard conditions Fig. 1 with image from Lenhart et al., 2013
atrioventricular canal development process characteristic, ameliorated nppauq19ks/uq19ks; nppbuq20ks/uq20ks + MO3-bmp4 standard conditions Fig. 4 with image from Grassini et al., 2018
atrium has2 expression spatial pattern, ameliorated nppauq19ks/uq19ks; nppbuq20ks/uq20ks + MO3-bmp4 standard conditions Fig. 4 with image from Grassini et al., 2018
atrium has2 expression position, ameliorated nppauq19ks/uq19ks; nppbuq20ks/uq20ks + MO3-bmp4 standard conditions Fig. 4 with image from Grassini et al., 2018
atrium cardiac jelly thickness, ameliorated nppauq19ks/uq19ks; nppbuq20ks/uq20ks; uq25bhTg + MO3-bmp4 standard conditions Fig. 4 with image from Grassini et al., 2018
atrium cardiac jelly development process characteristic, ameliorated nppauq19ks/uq19ks; nppbuq20ks/uq20ks; uq25bhTg + MO3-bmp4 standard conditions Fig. 4 with image from Grassini et al., 2018
Citations