Morpholino

MO3-clmpa

ID
ZDB-MRPHLNO-120320-9
Name
MO3-clmpa
Previous Names
None
Target
Sequence
5' - GGCACACACCAGCACTCACCACTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-clmpa
No data available
Phenotype
Phenotype resulting from MO3-clmpa
Phenotype Fish Figures
digestive tract development disrupted, abnormal WT + MO3-clmpa Fig. 5 from Werf et al., 2012
embryo development disrupted, abnormal WT + MO3-clmpa Fig. 5 from Werf et al., 2012
embryonic morphogenesis delayed, abnormal AB + MO3-clmpa Fig. 4 with image from Chen et al., 2025
gut morphology, abnormal WT + MO3-clmpa Fig. 5 from Werf et al., 2012
intestinal bulb decreased length, abnormal AB + MO3-clmpa Fig. 2 with image from Chen et al., 2025
intestine lacks all parts of type goblet cell, abnormal WT + MO3-clmpa Fig. 5 from Werf et al., 2012
intestine peristalsis decreased process quality, abnormal AB + MO3-clmpa Fig. 3 with image from Chen et al., 2025
mid intestine decreased length, abnormal AB + MO3-clmpa Fig. 2 with image from Chen et al., 2025
pericardium edematous, abnormal AB + MO3-clmpa Fig. 4 with image from Chen et al., 2025
post-vent region curled, abnormal AB + MO3-clmpa Fig. 4 with image from Chen et al., 2025
posterior intestine decreased length, abnormal AB + MO3-clmpa Fig. 2 with image from Chen et al., 2025
whole organism tagln expression decreased amount, abnormal AB + MO3-clmpa Fig. 4 with image from Chen et al., 2025
whole organism acta2 expression decreased amount, abnormal AB + MO3-clmpa Fig. 4 with image from Chen et al., 2025
whole organism fabp2 expression decreased amount, abnormal AB + MO3-clmpa Fig. 4 with image from Chen et al., 2025
whole organism clmpa expression decreased amount, abnormal AB + MO3-clmpa Fig. 2 with imageFig. 4 with image from Chen et al., 2025
whole organism myh11a expression decreased amount, abnormal AB + MO3-clmpa Fig. 4 with image from Chen et al., 2025
whole organism smoc2 expression decreased amount, abnormal AB + MO3-clmpa Fig. 4 with image from Chen et al., 2025
whole organism decreased length, abnormal WT + MO3-clmpa Fig. 2 with image from Chen et al., 2025
Fig. 5 from Werf et al., 2012
Phenotype of all Fish created by or utilizing MO3-clmpa
Phenotype Fish Conditions Figures
whole organism acta2 expression decreased amount, abnormal AB + MO3-clmpa control Fig. 4 with image from Chen et al., 2025
post-vent region curled, abnormal AB + MO3-clmpa control Fig. 4 with image from Chen et al., 2025
intestine peristalsis decreased process quality, abnormal AB + MO3-clmpa control Fig. 3 with image from Chen et al., 2025
posterior intestine decreased length, abnormal AB + MO3-clmpa control Fig. 2 with image from Chen et al., 2025
whole organism clmpa expression decreased amount, abnormal AB + MO3-clmpa control Fig. 2 with imageFig. 4 with image from Chen et al., 2025
whole organism myh11a expression decreased amount, abnormal AB + MO3-clmpa control Fig. 4 with image from Chen et al., 2025
mid intestine decreased length, abnormal AB + MO3-clmpa control Fig. 2 with image from Chen et al., 2025
whole organism tagln expression decreased amount, abnormal AB + MO3-clmpa control Fig. 4 with image from Chen et al., 2025
pericardium edematous, abnormal AB + MO3-clmpa control Fig. 4 with image from Chen et al., 2025
whole organism smoc2 expression decreased amount, abnormal AB + MO3-clmpa control Fig. 4 with image from Chen et al., 2025
whole organism decreased length, abnormal AB + MO3-clmpa control Fig. 2 with image from Chen et al., 2025
whole organism fabp2 expression decreased amount, abnormal AB + MO3-clmpa control Fig. 4 with image from Chen et al., 2025
embryonic morphogenesis delayed, abnormal AB + MO3-clmpa control Fig. 4 with image from Chen et al., 2025
intestinal bulb decreased length, abnormal AB + MO3-clmpa control Fig. 2 with image from Chen et al., 2025
intestine lacks all parts of type goblet cell, abnormal WT + MO3-clmpa standard conditions Fig. 5 from Werf et al., 2012
gut morphology, abnormal WT + MO3-clmpa standard conditions Fig. 5 from Werf et al., 2012
digestive tract development disrupted, abnormal WT + MO3-clmpa standard conditions Fig. 5 from Werf et al., 2012
embryo development disrupted, abnormal WT + MO3-clmpa standard conditions Fig. 5 from Werf et al., 2012
whole organism decreased length, abnormal WT + MO3-clmpa standard conditions Fig. 5 from Werf et al., 2012
Citations