Morpholino

MO6-ptk2ab

ID
ZDB-MRPHLNO-190312-3
Name
MO6-ptk2ab
Previous Names
  • fak1atMO1 (1)
Target
Sequence
5' - GTGGGTGCTAACTGTCCGTCATATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-ptk2ab
No data available
Phenotype
Phenotype resulting from MO6-ptk2ab
Phenotype Fish Figures
blastoderm anatomical margin morphology, abnormal WT + MO6-ptk2ab Figure 3. with image from Hung et al., 2020
convergent extension spatial distribution of a process, abnormal WT + MO6-ptk2ab Figure 4. with image,  Figure 8. with image,  Figure 9. with image from Hung et al., 2020
epiboly arrested, abnormal WT + MO6-ptk2ab Figure 2. with image from Hung et al., 2020
epiboly delayed, abnormal WT + MO6-ptk2ab Figure 2. with image from Hung et al., 2020
epiboly disrupted, abnormal WT + MO6-ptk2ab Figure 3. with image from Hung et al., 2020
EVL cell migration asynchronous, abnormal WT + MO6-ptk2ab Figure 3. with image from Hung et al., 2020
hypoblast cell migration decreased linear velocity, abnormal WT + MO6-ptk2ab Figure 5. with image from Hung et al., 2020
hypoblast cell migration decreased rate, abnormal WT + MO6-ptk2ab Figure 5. with image from Hung et al., 2020
hypoblast cell migration disrupted, abnormal WT + MO6-ptk2ab Figure 5. with image from Hung et al., 2020
hypoblast cell migration process quality, abnormal WT + MO6-ptk2ab Figure 5. with image from Hung et al., 2020
margin actin filament bundle decreased amount, abnormal WT + MO6-ptk2ab Figure 3. with image,  Figure 9. with image from Hung et al., 2020
prechordal plate cell migration decreased linear velocity, abnormal WT + MO6-ptk2ab Figure 5. with image from Hung et al., 2020
prechordal plate cell migration disrupted, abnormal WT + MO6-ptk2ab Figure 5. with image from Hung et al., 2020
prechordal plate cell migration process quality, abnormal WT + MO6-ptk2ab Figure 5. with image from Hung et al., 2020
somite increased width, abnormal WT + MO6-ptk2ab Figure 4. with image from Hung et al., 2020
tail bud hypoplastic, abnormal WT + MO6-ptk2ab Figure 4. with image from Hung et al., 2020
whole organism rac1l expression decreased amount, abnormal WT + MO6-ptk2ab Figure 9. with image from Hung et al., 2020
whole organism axis decreased length, abnormal WT + MO6-ptk2ab Figure 4. with image from Hung et al., 2020
yolk syncytial layer nucleus spatial pattern, abnormal WT + MO6-ptk2ab Figure 3. with image from Hung et al., 2020
Phenotype of all Fish created by or utilizing MO6-ptk2ab
Phenotype Fish Conditions Figures
epiboly delayed, abnormal WT + MO6-ptk2ab standard conditions Figure 2. with image from Hung et al., 2020
prechordal plate cell migration process quality, abnormal WT + MO6-ptk2ab standard conditions Figure 5. with image from Hung et al., 2020
margin actin filament bundle decreased amount, abnormal WT + MO6-ptk2ab standard conditions Figure 3. with image,  Figure 9. with image from Hung et al., 2020
prechordal plate cell migration decreased linear velocity, abnormal WT + MO6-ptk2ab standard conditions Figure 5. with image from Hung et al., 2020
convergent extension spatial distribution of a process, abnormal WT + MO6-ptk2ab standard conditions Figure 4. with image,  Figure 8. with image,  Figure 9. with image from Hung et al., 2020
epiboly disrupted, abnormal WT + MO6-ptk2ab standard conditions Figure 3. with image from Hung et al., 2020
hypoblast cell migration disrupted, abnormal WT + MO6-ptk2ab standard conditions Figure 5. with image from Hung et al., 2020
somite increased width, abnormal WT + MO6-ptk2ab standard conditions Figure 4. with image from Hung et al., 2020
hypoblast cell migration decreased linear velocity, abnormal WT + MO6-ptk2ab standard conditions Figure 5. with image from Hung et al., 2020
hypoblast cell migration process quality, abnormal WT + MO6-ptk2ab standard conditions Figure 5. with image from Hung et al., 2020
prechordal plate cell migration disrupted, abnormal WT + MO6-ptk2ab standard conditions Figure 5. with image from Hung et al., 2020
epiboly arrested, abnormal WT + MO6-ptk2ab standard conditions Figure 2. with image from Hung et al., 2020
whole organism rac1l expression decreased amount, abnormal WT + MO6-ptk2ab standard conditions Figure 9. with image from Hung et al., 2020
tail bud hypoplastic, abnormal WT + MO6-ptk2ab standard conditions Figure 4. with image from Hung et al., 2020
EVL cell migration asynchronous, abnormal WT + MO6-ptk2ab standard conditions Figure 3. with image from Hung et al., 2020
yolk syncytial layer nucleus spatial pattern, abnormal WT + MO6-ptk2ab standard conditions Figure 3. with image from Hung et al., 2020
whole organism axis decreased length, abnormal WT + MO6-ptk2ab standard conditions Figure 4. with image from Hung et al., 2020
blastoderm anatomical margin morphology, abnormal WT + MO6-ptk2ab standard conditions Figure 3. with image from Hung et al., 2020
hypoblast cell migration decreased rate, abnormal WT + MO6-ptk2ab standard conditions Figure 5. with image from Hung et al., 2020
Citations