Genomic Feature
ihb194
- ID
- ZDB-ALT-171016-3
- Name
- ihb194
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one insertion (1)
- Protocol
- embryos treated with
- Lab of Origin
- Yonghua Sun Lab
- Current Source
- China Zebrafish Resource Center (CZRC) ( order this )
- Other Pages
Notes
No data available
Variants
- Variant Type
- Insertion
- Variant Location
- Chr: 13 Details
- Nucleotide Change
- Variant Notes
-
23bps, TCCCGGGTCCACTCCCAGTGTAC , are inserted in exon1 of irf1a genomic DNA.
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- 23 bp inserted in Exon 1 (1)
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None