| ZFIN ID: ZDB-GENE-980526-168 |
| Gene Name: | cyclin E1 |
|---|---|
| Symbol: | ccne1 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing ccne1 | |
|---|---|
| DKEY-56M16 | Chr: 7 Details |
| CH211-260E23 | Chr: 7 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa8454 | 7 | 47,812,751 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 7 | 46,025,940 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 7 | 45,753,574 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 7 | 47,635,463 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| sa17090 | 7 | 47,812,310 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 7 | 46,025,497 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 7 | 45,753,131 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 7 | 47,635,020 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| sa25369 | 7 | 47,812,597 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 7 | 46,025,786 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 7 | 45,753,420 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 7 | 47,635,309 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| ihb541 | 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| ihb542 | 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| sa8454 | 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| sa17090 | 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| sa25369 | 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 7 | 111.6 cM | cyce | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 7 | 176.01 cR | cyce | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 7 | 94.5 cM | ccne | Heat Shock (HS) | Woods, Ian G. | Data |
| 7 | 75.84 cM | cyce | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z1182 | SSLP | 7 | 7.5 cM | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. |
| isl2b | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| foxb1b | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| z1059 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| z3445 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| z4706 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| ache | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| en2a | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| shha | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. |
| Markers Encoded by ccne1 | |||
|---|---|---|---|
| fa18e07 Chr: 7 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 563 | Tsp509I | 36.0 |
| Forward Primer | AGAGAGCACCATCTCTTGACTT | ||
| Reverse Primer | CAAACACTCAGAAGTTGACCAG |
| Genomic Feature ihb541 is an allele of ccne1 |