ZFIN ID: ZDB-GENE-980526-111

Mapping Details

Gene Name: ependymin
Symbol: epd
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
Vega 5 37,237,092 - 37,239,157 GRCv10
NCBI Map Viewer 5 37,837,245 - 37,839,310 GRCz11
Mapped Clones containing epd
CH211-139A5 Chr: 5 Details
CH211-69I14 Chr: 5 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 105.8 cM epd Mother of Pearl (MOP) Postlethwait, John H. Data
5 2891.0 cR epd Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
apoa1a GENE 5 Rajarao et al., 2002 Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
dmrt2a GENE 5 Rajarao et al., 2002 Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
z8122 SSLP 5 Rajarao et al., 2002 Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
zehn1245 EST 5 Rajarao et al., 2002 Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
atp1b2b GENE 5 Rajarao et al., 2002 Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
ins GENE 5 Rajarao et al., 2002 Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.

OTHER MAPPING INFORMATION
Chr 5 Rajarao et al., 2002 Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to  ...
Markers Encoded by epd
fj34b05 Chr: 5 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 851 SspI 36.0
Forward Primer GCTGACCAGTGGAACGATGA
Reverse Primer CGTGAGTGGTGTCCTCAACA