| ZFIN ID: ZDB-GENE-980526-212 | 
| Gene Name: | distal-less homeobox 2a | 
|---|---|
| Symbol: | dlx2a | 
PHYSICAL MAP AND BROWSER
                    
                    
                
            
        
    
    
        
        
            
    
    
    |  | ||||||||||||||||
| 
 | 
| Mapped Clones containing dlx2a | |
|---|---|
| CH211-245G15 | Chr: 9 Details | 
PHYSICAL MAPPING 
                    
                    
                
            
        
    
    
        
        
    | Feature | Chr | Position | Assembly | Source | DetailedSource | Citations | 
|---|---|---|---|---|---|---|
| sa11175 | 9 | 3,415,203 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 9 | 3,400,387 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 3,428,858 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 3,396,837 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| ot501 | 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| sa11175 | 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | 
| Chr | Location | Mapped As | Panel | Mapped By | Scoring | 
|---|---|---|---|---|---|
| 9 | 7.5 cM | dlx2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data | 
| 9 | 163.03 cR | dlx2 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data | 
| 9 | 0.0 cM | dlx2 | Heat Shock (HS) | Woods, Ian G. | Data | 
| Note: Physical map location as
            displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. | |||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] | 
|---|---|---|---|
| SJD | 713 | Tsp509I | 36.0 | 
| Forward Primer | AGCCACCACTTCATCACAAT | ||
| Reverse Primer | AGATGTTCATTCGGCTTTCA | 
