ZFIN ID: ZDB-GENE-980526-29

ZFIN ID: ZDB-GENE-980526-29

Mapping Details

Gene Name:	deltaA
Symbol:	dla

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	1	57,493,665 - 57,506,500	GRCz12tu
NCBI Map Viewer	1	57,493,665 - 57,506,500	GRCz12tu
Ensembl	1	54,013,457 - 54,026,180	GRCz11
NCBI Map Viewer	1	54,013,455 - 54,026,180	GRCz11
UCSC	1	-	GRCz11
Vega	1	53,353,714 - 53,366,437	GRCv10

Mapped Clones containing dla
CH211-133L11	Chr: 1 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
dx2	1	54,018,777	GRCz11	DIRECT		Appel et al., 1999
hi781Tg	1	54,014,034 - 54,014,035	GRCz11	DIRECT		ZFIN Curated Data
hi840Tg	1	54,014,153 - 54,014,154	GRCz11	DIRECT		ZFIN Curated Data
hi3499Tg	1	54,013,553 - 54,013,554	GRCz11	DIRECT		ZFIN Curated Data
ion29h	1	54,014,249 - 54,014,252	GRCz11	DIRECT		Jin et al., 2022
sa19611	1	57,495,000	GRCz12tu	DIRECT		Sealy et al., 2025
	1	54,014,790	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	1	53,355,047	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	1	54,581,544	Zv9	DIRECT		Busch-Nentwich et al., 2013
dx2	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
hi781Tg	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
hi840Tg	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
hi3499Tg	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
ion29h	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
nkhspGFFDMC72AEt	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
sa19611	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
zko1078a	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
zko1078b	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
1	167.3 cM	deltaa	Mother of Pearl (MOP)	Postlethwait, John H.	Data
1	6594.0 cR	dla	Goodfellow T51 (T51)	Geisler, Robert	Data
1	92.9 cM	dla	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by dla
fa04c10 Chr: 1 Details

Primer Sets:
Strain	Bandsize	Annealing Temperature [C]
SJD	452	36.0
Forward Primer	GAGCGGCGGGAGAAGGAC
Reverse Primer	TGGCAGAGCAGCATGTAGAGGA