Mapping Details

Genome Browser Chr Position Assembly Vega 21 37,498,712 - 37,509,505 GRCv10 NCBI Map Viewer 21 37,183,893 - 37,194,703 GRCz11

Mapped Clones containing fgfr4
CH211-281E1	Chr: 21 Details
DKEY-53B2	Chr: 21 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
21	94.8 cM	fgfr4	Mother of Pearl (MOP)	Postlethwait, John H.	Data
21	263.89 cR	fgfr4	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
21	2832.0 cR	fgfr4	Goodfellow T51 (T51)	Geisler, Robert	Data
21	101.5 cM	fgfr4	Heat Shock (HS)	Woods, Ian G.	Data
21	64.11 cM	fgfr4	Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
ubtd2	GENE	21		Guyon et al., 2005	Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21  ... Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21 using the T51 radiation hybrid panel 1.1Mb from the fgfr4 gene and next to the zgc:91797 gene.
sgcd	GENE	21		Guyon et al., 2005	Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21  ... Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21 using the T51 radiation hybrid panel 1.1Mb from the fgfr4 gene and next to the zgc:91797 gene.

OTHER MAPPING INFORMATION

Chr 21 Guyon et al., 2005 Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21 using the T51 radiation  ... Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21 using the T51 radiation hybrid panel 1.1Mb from the fgfr4 gene and next to the zgc:91797 gene.

Markers Encoded by fgfr4
fc13h10 Chr: 21 Details

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	1336	TaqI;Tsp509I;NlaIII	36.0
Forward Primer	CCTCCAGCTCATGCTCTTCA
Reverse Primer	GCTGACCATTTGTCCCAGAA