| Morpholino Name: | MO1-gata1a | 
    
        
        | Target: | gata1a  (1) | 
    
        
    
        
    
    
    | Previous Names: | gata1 MO (1), 
            
                MO(T)-gata1 (1), 
            
                MO1-gata1, 
            
                Gata1 morpholino (1) | 
    | 
    
        Attributions for Alias: {{control.newAlias}}
     
    
        Delete Alias: 
        
    
    (Including Attributions)
    
 | 
    
    
    
        | Sequence: | 
                        5' - CTGCAAGTGTAGTATTGAAGATGTC - 3'
                        
                     | 
    
    
        |  | (Although ZFIN verifies reagent sequence data, we recommend that you
                    conduct independent sequence analysis before ordering any reagent.) | 
    
    
        | Note: | A translation blocking morpholino targeting gata1. This morpholino sequence was reported with an additional nucleotide in Rhodes et al. 2005 and is correct as displayed here confirmed by author.
 |